ID: 1119652999_1119653003

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1119652999 1119653003
Species Human (GRCh38) Human (GRCh38)
Location 14:76396960-76396982 14:76396987-76397009
Sequence CCATTAATCTTGTGTCTCTGCGG TCCTCCCACGCCAGCCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94} {0: 1, 1: 0, 2: 34, 3: 1028, 4: 2590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!