ID: 1119662087_1119662095

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1119662087 1119662095
Species Human (GRCh38) Human (GRCh38)
Location 14:76459397-76459419 14:76459410-76459432
Sequence CCCCATGTGGGACCTGGAGAAAC CTGGAGAAACAGAGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169} {0: 1, 1: 2, 2: 2, 3: 58, 4: 653}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!