ID: 1119665057_1119665072

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1119665057 1119665072
Species Human (GRCh38) Human (GRCh38)
Location 14:76479591-76479613 14:76479642-76479664
Sequence CCCTGGAGAGCCCAGGAGCAGGA GGGCTGCCTACACTCTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 46, 4: 442} {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!