ID: 1119684837_1119684845

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1119684837 1119684845
Species Human (GRCh38) Human (GRCh38)
Location 14:76623352-76623374 14:76623371-76623393
Sequence CCCTCCTCCCTTCTTCTCCACAT ACATGAAGGTCCTTTCCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 167, 4: 1636} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!