ID: 1119700761_1119700772

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1119700761 1119700772
Species Human (GRCh38) Human (GRCh38)
Location 14:76753016-76753038 14:76753062-76753084
Sequence CCCTCAACGGGGAGAGGATCCAC AGCACAACTGATGGGTAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!