ID: 1119705438_1119705444

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1119705438 1119705444
Species Human (GRCh38) Human (GRCh38)
Location 14:76780024-76780046 14:76780053-76780075
Sequence CCATCTTGGCTTGGGGTTGCAAT TGGGCCAGTCACTTGTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129} {0: 1, 1: 0, 2: 3, 3: 37, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!