ID: 1119705729_1119705731

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1119705729 1119705731
Species Human (GRCh38) Human (GRCh38)
Location 14:76781541-76781563 14:76781555-76781577
Sequence CCTGGTTCTGGAGTCTTAGGAGG CTTAGGAGGTTCCAACTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150} {0: 1, 1: 0, 2: 1, 3: 2, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!