ID: 1119744509_1119744516

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1119744509 1119744516
Species Human (GRCh38) Human (GRCh38)
Location 14:77034223-77034245 14:77034273-77034295
Sequence CCAGGATCTTCAAATATTTTGGC AACTCAGGAGAGAGGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 160, 4: 1345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!