|
Left Crispr |
Right Crispr |
| Crispr ID |
1119753916 |
1119753924 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:77100394-77100416
|
14:77100435-77100457
|
| Sequence |
CCCAAGCCCAGCTAATTTTTGTG |
TTTCACCATATTGGCCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644} |
{0: 10089, 1: 109748, 2: 162818, 3: 167876, 4: 157265} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|