ID: 1119754547_1119754552

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1119754547 1119754552
Species Human (GRCh38) Human (GRCh38)
Location 14:77105965-77105987 14:77106004-77106026
Sequence CCTGCTTTAAAATGGTAATTCTG TACCCATCAAAGTCACCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 269} {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!