ID: 1119757135_1119757137

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1119757135 1119757137
Species Human (GRCh38) Human (GRCh38)
Location 14:77126971-77126993 14:77126987-77127009
Sequence CCTTAGCTGGGAAAGATCTAGGG TCTAGGGACCCCCATTTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} {0: 1, 1: 0, 2: 0, 3: 5, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!