ID: 1119766791_1119766801

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1119766791 1119766801
Species Human (GRCh38) Human (GRCh38)
Location 14:77195571-77195593 14:77195623-77195645
Sequence CCCTCCTCCTGCAGATGATTCTG CTCCCCCAGCTCAACCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 237} {0: 1, 1: 0, 2: 3, 3: 27, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!