ID: 1119801818_1119801820

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1119801818 1119801820
Species Human (GRCh38) Human (GRCh38)
Location 14:77452187-77452209 14:77452228-77452250
Sequence CCAAGCTATATTAACACATAAAA TGCTACTGCTTGTGTAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 182, 4: 993} {0: 1, 1: 0, 2: 4, 3: 24, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!