ID: 1119806840_1119806852

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1119806840 1119806852
Species Human (GRCh38) Human (GRCh38)
Location 14:77487747-77487769 14:77487771-77487793
Sequence CCCCAGGAGATGCCAGAAGAGGG AGGGGAGCGAGACAGGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 336} {0: 1, 1: 1, 2: 6, 3: 159, 4: 1351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!