ID: 1119808540_1119808548

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1119808540 1119808548
Species Human (GRCh38) Human (GRCh38)
Location 14:77498416-77498438 14:77498456-77498478
Sequence CCGGCTGGTCCGCGGCAGCCCGG GGAGTGGAAGCCCCGAAGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 187} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!