ID: 1119815619_1119815626

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1119815619 1119815626
Species Human (GRCh38) Human (GRCh38)
Location 14:77564179-77564201 14:77564210-77564232
Sequence CCGAAATTGTGCTGCTGCACTCC CAACAGAGGGAGACTCTGTCTGG
Strand - +
Off-target summary {0: 5, 1: 110, 2: 1554, 3: 20361, 4: 66468} {0: 2, 1: 48, 2: 168, 3: 379, 4: 812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!