|
Left Crispr |
Right Crispr |
Crispr ID |
1119815619 |
1119815626 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:77564179-77564201
|
14:77564210-77564232
|
Sequence |
CCGAAATTGTGCTGCTGCACTCC |
CAACAGAGGGAGACTCTGTCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 110, 2: 1554, 3: 20361, 4: 66468} |
{0: 2, 1: 48, 2: 168, 3: 379, 4: 812} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|