ID: 1119851925_1119851930

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1119851925 1119851930
Species Human (GRCh38) Human (GRCh38)
Location 14:77872462-77872484 14:77872486-77872508
Sequence CCAATCATAAGGTGGCTGAGGAG TTCTTGAAGAAGAGGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 1, 1: 0, 2: 4, 3: 55, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!