ID: 1119898675_1119898684

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1119898675 1119898684
Species Human (GRCh38) Human (GRCh38)
Location 14:78242371-78242393 14:78242389-78242411
Sequence CCCTCCCCCTCTTCCCACAGGTC AGGTCTTTTCTCTGGAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 760} {0: 1, 1: 0, 2: 1, 3: 28, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!