ID: 1119936837_1119936849

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1119936837 1119936849
Species Human (GRCh38) Human (GRCh38)
Location 14:78599847-78599869 14:78599891-78599913
Sequence CCCATGAAAAGCTTGCTGCCTGG ACCAGCTATCATTATAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!