ID: 1119941231_1119941235

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1119941231 1119941235
Species Human (GRCh38) Human (GRCh38)
Location 14:78643812-78643834 14:78643839-78643861
Sequence CCTCAGACCTTGCAATATGTATG GCCTTTAGAAAGATGGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153} {0: 1, 1: 0, 2: 0, 3: 6, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!