ID: 1119941606_1119941616

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1119941606 1119941616
Species Human (GRCh38) Human (GRCh38)
Location 14:78647287-78647309 14:78647315-78647337
Sequence CCGCCCCTGCCCTTCATGTTCTA CAACTCTGCTCTGTGCCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 410} {0: 1, 1: 0, 2: 3, 3: 44, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!