ID: 1119951999_1119952005

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1119951999 1119952005
Species Human (GRCh38) Human (GRCh38)
Location 14:78754706-78754728 14:78754727-78754749
Sequence CCCACTCCACTCTAGACCTACTG TGAACCAGAAACTCTGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187} {0: 1, 1: 25, 2: 154, 3: 515, 4: 1299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!