ID: 1119957044_1119957055

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1119957044 1119957055
Species Human (GRCh38) Human (GRCh38)
Location 14:78809680-78809702 14:78809710-78809732
Sequence CCTATGCAAATTTCTATAGCATT CAACCTAAGGAGAGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 378} {0: 1, 1: 0, 2: 0, 3: 20, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!