|
Left Crispr |
Right Crispr |
| Crispr ID |
1119967381 |
1119967387 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:78931972-78931994
|
14:78931989-78932011
|
| Sequence |
CCCTGTCTCTACTACAAAATTAG |
AATTAGCTGGGCATGGTGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 30, 2: 212, 3: 2183, 4: 17571} |
{0: 8458, 1: 30905, 2: 62491, 3: 77788, 4: 55705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|