ID: 1119972495_1119972496

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1119972495 1119972496
Species Human (GRCh38) Human (GRCh38)
Location 14:78987220-78987242 14:78987240-78987262
Sequence CCAGGTTGTGGTCGTCTGAGAAC AACTACACATTGAGAACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69} {0: 1, 1: 2, 2: 28, 3: 138, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!