ID: 1119978684_1119978687

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1119978684 1119978687
Species Human (GRCh38) Human (GRCh38)
Location 14:79054922-79054944 14:79054962-79054984
Sequence CCATTTGTGAGCTGCAGGGTTCA ATGTAAATACAGTGGTAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160} {0: 1, 1: 0, 2: 0, 3: 14, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!