ID: 1119998702_1119998711

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1119998702 1119998711
Species Human (GRCh38) Human (GRCh38)
Location 14:79279562-79279584 14:79279602-79279624
Sequence CCTCTTTCCCTCCAGTCCTTCTT GCGGTGGCTGCTGCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 174, 4: 1764} {0: 1, 1: 2, 2: 38, 3: 300, 4: 1119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!