ID: 1120007453_1120007457

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1120007453 1120007457
Species Human (GRCh38) Human (GRCh38)
Location 14:79375437-79375459 14:79375490-79375512
Sequence CCTGCTGAAGTCTCAGGAGTGTC AAAAGCAGAGTGCCTTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161} {0: 1, 1: 1, 2: 3, 3: 19, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!