ID: 1120011729_1120011733

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1120011729 1120011733
Species Human (GRCh38) Human (GRCh38)
Location 14:79423199-79423221 14:79423213-79423235
Sequence CCCATGTGTAGCAAACATATCAA ACATATCAACTACTCTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197} {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!