ID: 1120017195_1120017198

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1120017195 1120017198
Species Human (GRCh38) Human (GRCh38)
Location 14:79487456-79487478 14:79487508-79487530
Sequence CCAATTCAGTGTCTCGTATCAAA ACTCAAAACCCTATGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99} {0: 1, 1: 0, 2: 1, 3: 14, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!