ID: 1120024776_1120024781

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1120024776 1120024781
Species Human (GRCh38) Human (GRCh38)
Location 14:79570516-79570538 14:79570548-79570570
Sequence CCCTCAGGTCAGAAAATATGTGC CCTGAGATGCTGACTGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 189} {0: 1, 1: 0, 2: 2, 3: 18, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!