ID: 1120042228_1120042238

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1120042228 1120042238
Species Human (GRCh38) Human (GRCh38)
Location 14:79767202-79767224 14:79767218-79767240
Sequence CCTTCTTCCTCCCAGCCCTACTG CCTACTGGGGCCCATTCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 632} {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!