ID: 1120080827_1120080831

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120080827 1120080831
Species Human (GRCh38) Human (GRCh38)
Location 14:80214258-80214280 14:80214299-80214321
Sequence CCCCTGCAGTGGAGACTTCAGCA CTCACTTGCTTTTGCTCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212} {0: 1, 1: 0, 2: 3, 3: 20, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!