ID: 1120091537_1120091543

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1120091537 1120091543
Species Human (GRCh38) Human (GRCh38)
Location 14:80337854-80337876 14:80337901-80337923
Sequence CCTGAACTGATCTCCTTAAAATT CTTTCACCACACCTGGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 202} {0: 1, 1: 0, 2: 1, 3: 36, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!