ID: 1120105139_1120105141

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1120105139 1120105141
Species Human (GRCh38) Human (GRCh38)
Location 14:80485478-80485500 14:80485497-80485519
Sequence CCAACCTCAAATTGTGTATAACT AACTATTATCATTGCTAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153} {0: 1, 1: 0, 2: 2, 3: 25, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!