ID: 1120115279_1120115295

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1120115279 1120115295
Species Human (GRCh38) Human (GRCh38)
Location 14:80609459-80609481 14:80609498-80609520
Sequence CCCTCTGGCCCCCACCCCCATCC TCCATTTTCCCACATGGTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 175, 4: 1317} {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!