ID: 1120121068_1120121073

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1120121068 1120121073
Species Human (GRCh38) Human (GRCh38)
Location 14:80680632-80680654 14:80680653-80680675
Sequence CCCTCTGCAGTCCATACCCACAT ATGTATCTCCAAGAATCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 181} {0: 1, 1: 0, 2: 2, 3: 12, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!