ID: 1120124189_1120124191

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1120124189 1120124191
Species Human (GRCh38) Human (GRCh38)
Location 14:80720896-80720918 14:80720925-80720947
Sequence CCAAATTCTCTACCACAATCTAT CAGAGAAAACCTAAGTATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 237} {0: 1, 1: 0, 2: 3, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!