ID: 1120124190_1120124191

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120124190 1120124191
Species Human (GRCh38) Human (GRCh38)
Location 14:80720908-80720930 14:80720925-80720947
Sequence CCACAATCTATACAACACAGAGA CAGAGAAAACCTAAGTATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239} {0: 1, 1: 0, 2: 3, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!