ID: 1120129530_1120129541

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1120129530 1120129541
Species Human (GRCh38) Human (GRCh38)
Location 14:80788712-80788734 14:80788756-80788778
Sequence CCTCTCTTGCCCCTTACCCTACT AATTTAGGCTATTTTACTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 392} {0: 1, 1: 0, 2: 3, 3: 17, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!