ID: 1120174348_1120174351

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120174348 1120174351
Species Human (GRCh38) Human (GRCh38)
Location 14:81277394-81277416 14:81277435-81277457
Sequence CCACTTTGTGGTGGTGGTGGGCA CTATTTCATTCCCTTTGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 245} {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!