ID: 1120178967_1120178973

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120178967 1120178973
Species Human (GRCh38) Human (GRCh38)
Location 14:81324063-81324085 14:81324080-81324102
Sequence CCTCTTGGGCTGGGGTGAGGGTG AGGGTGGCGAGGGGTCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 78, 4: 500} {0: 1, 1: 0, 2: 3, 3: 41, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!