ID: 1120183351_1120183364

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120183351 1120183364
Species Human (GRCh38) Human (GRCh38)
Location 14:81367752-81367774 14:81367793-81367815
Sequence CCCCTCATTTCCCAGGCTCATGG CTCTGGGCCTGGAGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 279} {0: 1, 1: 1, 2: 10, 3: 74, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!