ID: 1120250741_1120250743

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1120250741 1120250743
Species Human (GRCh38) Human (GRCh38)
Location 14:82059649-82059671 14:82059676-82059698
Sequence CCAAGAGTGGTCTCTCAAAAAGA AATTATCTGCAAATGATGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 21, 3: 330, 4: 2236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!