ID: 1120269722_1120269734

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1120269722 1120269734
Species Human (GRCh38) Human (GRCh38)
Location 14:82296141-82296163 14:82296191-82296213
Sequence CCCTCAGACGGAGACATCCTTGG TTTGCAACACAGGCGTTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!