ID: 1120397381_1120397389

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120397381 1120397389
Species Human (GRCh38) Human (GRCh38)
Location 14:83985581-83985603 14:83985622-83985644
Sequence CCATCCACCACTGCTGTTTGCGC GACTTCCATCCCTCTGGATCCGG
Strand - +
Off-target summary No data {0: 25, 1: 61, 2: 115, 3: 90, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!