ID: 1120404513_1120404526

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1120404513 1120404526
Species Human (GRCh38) Human (GRCh38)
Location 14:84078386-84078408 14:84078418-84078440
Sequence CCCTGACCCCCTTTTCACTATCC CTGTTTGGACAAGTTAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 217} {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!