ID: 1120426056_1120426064

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1120426056 1120426064
Species Human (GRCh38) Human (GRCh38)
Location 14:84350225-84350247 14:84350268-84350290
Sequence CCGTGCCACTAGTCCCCCATCCC AGAGAGAGAATCTGTGCTTGTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 19, 3: 110, 4: 619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!