ID: 1120497500_1120497503

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1120497500 1120497503
Species Human (GRCh38) Human (GRCh38)
Location 14:85255140-85255162 14:85255153-85255175
Sequence CCCAGGAAAGTGGCAATCAAGAC CAATCAAGACTGGTTTCCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!