ID: 1120515463_1120515468

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1120515463 1120515468
Species Human (GRCh38) Human (GRCh38)
Location 14:85464926-85464948 14:85464969-85464991
Sequence CCACTGCTCCAGAAGGTGCAAGC ATGTGCTAGTTTAAGTCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!